5/2/2023 0 Comments Twizzle purple penstemon![]() ![]() ![]() Twizzle can be marketed as a premium plant in 12-18 cm / 4-7 in. The vigorous, well-branched plants bloom the first year, flower from June to September, and are beautiful in beds, borders, and containers. Sowing: Sow between February and April for first year flowers, or sow in September for early summer flowering the next year. Penstemon barbatus Twizzle Purple F1 2017 AAS Flower Winner Vibrant purple blooms present a new and unique color in penstemon Twizzle Purple was judged as a first-year flowering perennial by judges who were impressed with the upright plant habit and superb flowering performance. When started from an autumn sowing the plants will flower in spring and early summer the plants will bloom from a spring sowing in summer and late summer without vernalisation. Penstemon barbatus 'Twizzle Purple' is the winner of both an AAS and Fleuroselect Award, producing trumpet shaped magenta-violet blooms that flutter all along the tall, slender stems. Penstemon barbatus ‘Twizzle’ adds a graceful twist to the garden. Growers can grow Twizzle as a cool crop and also outside, for a long sales season. Trumpet-shaped, vibrant purple flowers are attractive in the border and useful for cutting. Well-established plants in the garden are fairly drought tolerant and winter hardy. Plants form a low clump of green foliage, with upright spikes appearing in mid-summer. This Penstemon series is pollinator friendly it attracts many kinds of bees and hummingbirds. Twizzle adds height and elegance to annual and perennial borders and can be used in various creative landscaping combinations. ![]() The plants have strong upright stems and long airy spikes with tubular flowers. All have a natural and elegant plant habit and an excellent garden performance. Twizzle is a first-year-flowering Penstemon series consisting of five beautiful colours and a mixture. Penstemon barbatus, Twizzle Purple Penstemon barbatus, Twizzle Purple Beard-Tongue Price: £2.85 Rich and vibrant, very dark pink-purple. ![]()
0 Comments
![]() ![]() Cut The Rope Time Travel – Ancient Egypt 4-8 Walkthrough 3 Stars.Cut The Rope Time Travel – Ancient Egypt 4-7 Walkthrough 3 Stars.Cut The Rope Time Travel – Ancient Egypt 4-6 Walkthrough 3 Stars.Cut The Rope Time Travel – Ancient Egypt 4-5 Walkthrough 3 Stars.Cut The Rope Time Travel – Ancient Egypt 4-4 Walkthrough 3 Stars.Cut The Rope Time Travel – Ancient Egypt 4-3 Walkthrough 3 Stars.Cut The Rope Time Travel – Ancient Egypt 4-2 Walkthrough 3 Stars.Cut The Rope Time Travel – Ancient Egypt 4-1 Walkthrough 3 Stars.Cut The Rope Time Travel – Ancient Egypt.Cut The Rope Time Travel – Pirate Ship 3-15 Walkthrough 3 Stars.Cut The Rope Time Travel – Pirate Ship 3-14 Walkthrough 3 Stars.Cut The Rope Time Travel – Pirate Ship 3-13 Walkthrough 3 Stars.Cut The Rope Time Travel – Pirate Ship 3-12 Walkthrough 3 Stars. ![]() Cut The Rope Time Travel – Pirate Ship 3-11 Walkthrough 3 Stars.Cut The Rope Time Travel – Pirate Ship 3-10 Walkthrough 3 Stars.Cut The Rope Time Travel – Pirate Ship 3-9 Walkthrough 3 Stars.Cut The Rope Time Travel – Pirate Ship 3-8 Walkthrough 3 Stars.Cut The Rope Time Travel – Pirate Ship 3-7 Walkthrough 3 Stars.Cut The Rope Time Travel – Pirate Ship 3-6 Walkthrough 3 Stars.Cut The Rope Time Travel – Pirate Ship 3-5 Walkthrough 3 Stars.Cut The Rope Time Travel – Pirate Ship 3-4 Walkthrough 3 Stars.Cut The Rope Time Travel – Pirate Ship 3-3 Walkthrough 3 Stars.Cut The Rope Time Travel – Pirate Ship 3-2 Walkthrough 3 Stars.Cut The Rope Time Travel – Pirate Ship 3-1 Walkthrough 3 Stars.Cut The Rope Time Travel – The Renaissance 2-15 Walkthrough 3 Stars.Cut The Rope Time Travel – The Renaissance 2-14 Walkthrough 3 Stars.Cut The Rope Time Travel – The Renaissance 2-13 Walkthrough 3 Stars.Cut The Rope Time Travel – The Renaissance 2-12 Walkthrough 3 Stars.Cut The Rope Time Travel – The Renaissance 2-11 Walkthrough 3 Stars.Cut The Rope Time Travel – The Renaissance 2-10 Walkthrough 3 Stars.Cut The Rope Time Travel – The Renaissance 2-9 Walkthrough 3 Stars.Cut The Rope Time Travel – The Renaissance 2-8 Walkthrough 3 Stars.Cut The Rope Time Travel – The Renaissance 2-7 Walkthrough 3 Stars.Cut The Rope Time Travel – The Renaissance 2-6 Walkthrough 3 Stars.Cut The Rope Time Travel – The Renaissance 2-5 Walkthrough 3 Stars.Cut The Rope Time Travel – The Renaissance 2-4 Walkthrough 3 Stars.Cut The Rope Time Travel – The Renaissance 2-3 Walkthrough 3 Stars.Cut The Rope Time Travel – The Renaissance 2-2 Walkthrough 3 Stars.Cut The Rope Time Travel – The Renaissance 2-1 Walkthrough 3 Stars.Cut The Rope Time Travel – The Renaissance.Cut The Rope Time Travel – The Middle Ages 1-15 Walkthrough 3 Stars.Cut The Rope Time Travel – The Middle Ages 1-14 Walkthrough 3 Stars.Cut The Rope Time Travel – The Middle Ages 1-13 Walkthrough 3 Stars.Cut The Rope Time Travel – The Middle Ages 1-12 Walkthrough 3 Stars.Cut The Rope Time Travel – The Middle Ages 1-11 Walkthrough 3 Stars.Cut The Rope Time Travel – The Middle Ages 1-10 Walkthrough 3 Stars.Cut The Rope Time Travel – The Middle Ages 1-9 Walkthrough 3 Stars.Cut The Rope Time Travel – The Middle Ages 1-8 Walkthrough 3 Stars.Cut The Rope Time Travel – The Middle Ages 1-7 Walkthrough 3 Stars.Cut The Rope Time Travel – The Middle Ages 1-6 Walkthrough 3 Stars.Cut The Rope Time Travel – The Middle Ages 1-5 Walkthrough 3 Stars.Cut The Rope Time Travel – The Middle Ages 1-4 Walkthrough 3 Stars.Cut The Rope Time Travel – The Middle Ages 1-3 Walkthrough 3 Stars.Cut The Rope Time Travel – The Middle Ages 1-2 Walkthrough 3 Stars.Cut The Rope Time Travel – The Middle Ages 1-1 Walkthrough 3 Stars.Cut The Rope Time Travel – The Middle Ages.If I have made any mistakes or you know of any Cut the Rope Time Travel Cheats or Tips I have missed, please feel free to comment or contact me!Ĭut the Rope Time Travel Game Cheats & TipsĬut the Rope Time Travel Video Level Guides Below, I have managed to gather all of the Cheats, Tips, and Glitches for the Cut the Rope Time Travel game, available in iTunes App Store and Google Play Store. ![]() 5/2/2023 0 Comments Currency rates chart![]() ![]() Source: FactSetĭata are provided 'as is' for informational purposes only and are not intended for trading purposes. Change value during other periods is calculated as the difference between the last trade and the most recent settle. Change value during the period between open outcry settle and the commencement of the next day's trading is calculated as the difference between the last trade and the prior day's settle. Sources: FactSet, Tullett PrebonĬommodities & Futures: Futures prices are delayed at least 10 minutes as per exchange requirements. Sources: FactSet, Tullett PrebonĬurrencies: Currency quotes are updated in real-time. Sources: FactSet, Dow Jonesīonds: Bond quotes are updated in real-time. Sources: FactSet, Dow JonesĮTF Movers: Includes ETFs & ETNs with volume of at least 50,000. Stock Movers: Gainers, decliners and most actives market activity tables are a combination of NYSE, Nasdaq, NYSE American and NYSE Arca listings. Overview page represent trading in all U.S. Indexes: Index quotes may be real-time or delayed as per exchange requirements refer to time stamps for information on any delays. Copyright 2019© FactSet Research Systems Inc. Fundamental company data and analyst estimates provided by FactSet. International stock quotes are delayed as per exchange requirements. stock quotes reflect trades reported through Nasdaq only comprehensive quotes and volume reflect trading in all markets and are delayed at least 15 minutes. This creates additional demand for dollars and leads to appreciation now.Stocks: Real-time U.S. If for some reason investors believe that the dollar will appreciate in one year, they will want to buy it now. We are not sure which effect would be stronger but usually a growing economy is associated with an appreciating currency.Įxpected appreciation of the dollar. imports increase since Americans can buy more international goods and services and cause dollar depreciation. On one hand, that attracts foreign investment and causes dollar appreciation. goods, the demand for dollars declines, and the dollar depreciates. That leads to greater foreign investment into the U.S., greater demand for dollars, and dollar appreciation. increases its international purchases and investments, that creates additional supply of dollars and the dollar will depreciate. increases, this will create more demand for dollars, and the dollar will appreciate. Holding all else constant, if foreign investment in the U.S. Foreigners want to buy dollars when they:Īt the same time U.S. when more people want to buy it and depreciates when the supply increases, i.e. The exchange rate appreciates when the demand for the currency increases, i.e. ![]() ![]() We say that a currency is appreciating/depreciating relative to another currency if it takes more/less units of the other currency to purchase it. The exchange rate is the price of one currency expressed in units of another currency. What factors determine the exchange rates ![]() 5/2/2023 0 Comments Celestial tea sleepytime![]() ![]() Leave Your MessageĪlso Check: What Is The Best Tea For Menopause A Simple Recipe For Delicious Nighttime Tea It’s also recommended to allow the tea steep for not more than 10 minutes before drinking it up.Īlthough the sleepytime time teas are effective in naturally aiding sleep, it’s imperative to note that the results the effects of sleepytime teas vary across individuals. It’s commonly recommended to take the tea 30 minutes to before bed. Sleepytime teas are popular for their mild tranquilizer effect and placebo effects, hence recommended to be taken before bedtime. How long before bed should you drink Sleepytime tea? The natural organic teals are linked to limited long-term effects unlike the non-natural supplements that have effects such as dizziness, headaches, muscle aches rebound insomnia among other effects. Consequently, the demand for popular brands of organic teas such as Celestial Sleepytime has grown exponentially. The sleepytime teas are naturally produced. The perennially popular organic teas have been used over centuries to stave off stress, insomnia, anxiety and stomach upsets. Substantive evidence demonstrates the medicinal properties of the herbal teas. Over time the sleepytime tea has increased in popularity as a sleep remedy. Sleep disorder is a common problem affecting a wider population resulting in the increasing use of sleep aid such as sleeping pills or herbal organic tea. Sleepytime blends are available in herbal, decaf green and wellness teas, so you can always find the perfect cup for any bedtime or daytime routine. We also introduced probiotics and other wellness benefits in our TeaWell line, which include Gut Health, Sleep with Melatonin, and more. Over the past year, we introduced bold new innovation in the green and black tea segments, adding new benefits like an Energy tea with as much caffeine as a cup of coffee. Thats one of the benefits of a wholesome, legacy brand. Usually, we just know when its right for Celestial. Then we propose various stories and vignettes that we want our customers to feel while drinking the tea. Theres significant time spent on the mood and feeling. We always start with the tea first, and then ask what is the emotion and experience we want to evoke. Celestial Seasonings Has Several Iconic Characters For Its Teas Including The Bengal Spice Tiger The Candy Cane Polar Bears And The Red Zinger Hummingbird How Do You Determine The Unique Icons For Tea Packaging The liquid melatonin assists in multiple areas such as lowering heart rate, lowering blood pressure, increasing immune functions and blocking stress responses. The chamomile works as a sleep inducer and as a mild tranquilizer. Oz’s Tired Tea uses chamomile and liquid melatonin as the main ingredients. Quality Ingredients: We blend or teas from the finest ingredients, with no artifical flavors, colors or preservatives.īox printed on 100% recycled paperboard (35% post-consumer content).Sleepytime Extra Tea ð´ðªð´ðð?ð | Tasty | Effective Responsible Sourcing: We purchase most of our ingredients directly from the farming communities that grow them. STEEP: Pour 1 cup water over a tea bag in a cup. Today, our calming Sleepytime blend of botanicals is available in herbal, decaf green and wellness teas, so you can always find the perfect cup for your bedtime routine.Ĭhamomile, Decaffeinated Green Tea, Spearmint, Lemongrass, Natural Lemon and Jasmine Flavors with other Natural Flavors, Tilia Flowers, Hawthorn, Ascorbic Acid (Vitamin C) and Rosebuds.īOIL: Bring fresh, filtered water to a rolling boil. More than 40 years ago, we created a truly soothing herbal tea to help folks wind down the day. We've also added antioxidant Vitamin C to support your everyday wellness. ![]() ![]() Smooth decaf green tea, lively lemon and fragrant jasmine meet our time-honored Sleepytime® blend of chamomile, spearmint and lemongrass. ![]() 5/2/2023 0 Comments Fez hat religion![]() ![]() Hirsch has spoken out before about Disney’s concerns with LGBTQ+ themes in “Gravity Falls. The diamond+circle looks slightly like the portal in Stan’s secret underground laboratory-UNDERGROUND. What is Grunkle Stan’s tattoo?Īt the bottom of the tattoo appears to look almost like two symbols for Iron facing each other, and on top of it is a diamond with a circle on it. Why is Grunkle Stan’s fez censored?Īccording to show cannon, the symbol was representational of a Masonic-like group Grunkle Stan was a part of, called the Royal Order of the Holy Mackerel, however other reports claim that the fictional sign resembled Islamic iconography and Masonry all too closely, which is why the decision was made to have it removed. Fez, Morocco (or Fes), the third-largest city of Morocco. Fez most often refers to: Fez (hat), a type of felt hat commonly worn in the Ottoman Empire. Look up Fez or fez in Wiktionary, the free dictionary. The V&A’s hat was given to Hans van Rijs in 1984 while he was working on a Dutch Bassett’s Winegums advertisement with the comedian. What hat Does Tommy Cooper wear?Īccording to legend, Tommy Cooper began wearing a fez when he lost his army-issue helmet while performing in Cairo during World War Two. In “Eric’s Burger Job”, during a job interview at Fatso Burger, Fez claims he can speak Dutch. What nationality is fez?įez is often assumed to be of Hispanic or Latino descent it is never revealed if this is so, though earlier episodes, such as “Sunday, Bloody Sunday”, imply he can speak Spanish. Definition: A Dirty Person (from “festerer”) (see also FEZZER) Does Aladdin wear a fez?Īladdin (2019 movie)In the 1992 animated classic, a musclebound Aladdin wears a purple waistcoat that shows off his pecs, with off-white harem pants, a crimson cummerbund, and a jaunty maroon fez hat. “A Dirty Person (from “festerer”) (see also FEZZER)” is the most common definition for FEZ on Snapchat, WhatsApp, Facebook, Twitter, Instagram, and TikTok. It also serves as an outward symbol of one’s membership in the fraternity. Named after the city of Fez, Morocco, the hat represented the Arabian theme the fraternity was founded on. The fez is one of the most recognizable symbols of Shriners International and was adopted as the Shriners’ official headgear in 1872. According to legend, it gives him special powers, like the ability to cover his bald spot, and a place to hide his parking tickets. Like all cool people, Stan wears a fez pretty much constantly. Is A Fez Hat Offensive – More related Questions Why does Stan wear a fez? Is the fez hat Moroccan? Man wearing a fez, a red, conical, flat-crowned felt hat topped with a tassel, that originated in the city of Fès, Morocco, in the early 19th century. His grandson, Khedive Abbas I, made it court garb. Home to the world’s oldest continuously in-use university - The University of Al-Karaouine, founded in 859 CE - Fez’s influence on the Arab world is vast.Īre fez hats Egyptian? The fez, or tarbush, was introduced in the 19th century by the founder of modern Egypt, Mohammed Ali Pasha. What culture is a fez? Located north-east of the fabled Atlas Mountains, Fez is Morocco’s cultural and spiritual capital, making it both revered and envied by its rival regions. Fez is now worn by service staff and tourist establishments in the Middle East and North Africa while in Libya, the fez is called “checheya” and is worn by the rural population sometimes with or without the long tassel. Jewish men wore the fez and referred to it by the Arabic name “Tarboush”, especially Arab-Jews (mostly Egyptian, Syrian and Palestinian). It was also the main headdress for Christians and Jews during the Ottoman Empire. What does a fez hat represent? The fez was a symbol not only of Ottoman affiliation but also of religious adherence to Islam. ![]() 5/2/2023 0 Comments Serial cloner xdna pet28a![]() I took five well separated colonies and then grew a 5 ml overnight culture. In the following day of transformation, I found many colonies (see attached PPT for picture). I incubated the Gibson reaction at 50oC for 1 hr in a PCR machine and then transformed 2 ul of assembly reaction in 50 ul of NEB 10-beta cell (High efficiency) following the transformation protocol for NEB beta cell as specified by NEB. After that, I set up a Gibson assembly following the instruction of NEB Gibson manual. Then, I digested 8 ul (296 ng/ul) of purified PCR product with DpnI (1 ul) in a 10 ul of total reaction volume (and incubated at 37oC for 30 mins) as suggested by NEB Gibson manual and heat inactivate the DpnI at 80oC for 20 mins. I eluted in 30 ul of nulcease free H2O and then measured the concentration of PCR product using NanoDrop and the concentration was 296 ng/ul. After that, I purified the PCR product using Promega PCR and gel purification kit. After PCR amplification, I checked 5 ul of my PCR product in the gel and found a nice clean single band and the size of this band matches to the expected size (for details see the attached PPT slide). I prepared my vector by PCR (primer designed by NEB builder software). I am using pGex-6p-1 vector to assemble these gBlocks using Gibson assembly. I have designed four gBlocks (each of which is ~1.7 kb) and synthesized them from IDT. I am trying to generate a bacterial operon construct. Could it be my competent cells introducing the mutations? Any help would be greatly appreciated! (Side note: my last two orders of master mix from NEB have smelled bad- almost sulfuric? Did I just not notice this before or is this a sign the mix is tainted?) The positive control still works and gives many colonies. I thought at first the polymerase in the master mix had gone bad, but I have tried buying fresh NEB Gibson Master Mix, and the same kind of mutations still happen. The mutations are often, but not always, near a "seam" where two fragments meet. ![]() It seems that these mutations are happening either during the assembly or the transformation. ![]() I got all of my fragments sequenced and I know that before the assembly, they have really clean reads. Most of them look good by restriction digest, but the sequencing results now always show random point mutations that differ from colony to colony, with some having only one mutation, others 5+. ![]() I am trying to assemble three fragments (900bp, 780bp, 300bp) and a backbone (9.5kb), and I do still get colonies. I have had a lot of success with Gibson reactions in the past, but all of a sudden, not only has my number of total colonies fallen, the percent of correct colonies has also fallen. GGGGGGGCATCGTTTTGTTCGCCCAGGACTCTAGCTATAGTTCTAGTGGTTGGCTACGTATACTCCGGAATATTAATAGATCATGGAGATAATTAAAATGATAACCATCTCGCAAATAAATAAGTATTTTACTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATATTCCGGATTATTCATACCGTCCCACCATCGGGCGCGGATCCCGGTCCGTTCGAACCCACCATCGGGCGCGGATCCCGTCCGTTCGAACCAGAACCATCGGGCGCGGATCCCGGTCCGTTCGAACCAGAACCACCATCGGGCGCGGATCCCGGTCCGTTCGAACCAGCCACCATCGGGCGCGGATCCCGGTCCGTTCGAGAAGTAATAGTTAATAGATAATAATAGCTCGAGGCAGCGGTACCAAGGTTAATAGATAATAATAGCTCGAGGCATGCGGTACCAAGTTAATAGATAATAATAGCTCGAGGCATGCGGTACCAAGTTAATAGATAATAATAGCTCGAGGCATGCGGTACCAAGCTTGTCGAGAAGTACTAGAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCTGATCACTGCTTGAGCCTAGGAGATCCGAACCAGATAAGTGAAATCTAGTTCCAAACTATTTTGTCATTTTTAATTTTCGTATTAGCTTACGACGCTACACCCAGTTCCCATCTATTTTGTCACTCTTCCCTAAATAATCCTTAAAAACTCCATTTCCACCCCTCCCAGTTCCCAACTATTTTGTCCGCCCACAGCGGGGCATTTTTCTTCCTGTTATGTTTTTAATCAAACATCCTGCCAACTCCATGTGACAAACCGTCATCTTCGCTACTTTTTCCTCTGTCACAGGATGAAAATTTTTCTGTCATCTCTCGTATAATGTTGTATGACTGAATATCACGCTTATTTGCAGCCTGATGGCGATGGACGCCGCCCTGTAGCGGGCGCCATAACCCCGCCGG ![]() ![]() You will also be able to create custom equipment for your character, using the game’s varied crafting system. Camelot Unchained offers various combinations of classes, factions and armaments, allowing you to develop your hero in a way most suited to your playstyle. The game features a real-time combat system and the outcomes of the battles are decided not only by the skills of heroes, but also by the player’s ability to use them effectively. To sum up, the PvP engagements and their results impact the entire geopolitical situation of the virtual world. ![]() It also affects most of the mechanics in Camelot Unchained, such as the virtual economy and the real estate which belongs to the players. The RvR gameplay is not limited to just battles. The developers have fully committed to the PvP aspect of the production, which features wars between the previously mentioned factions. The game lacks a PvE mode, which means there are no quests focusing on the plot, where you face enemies controlled by the AI the only AI opponents you will meet can be found in the tutorials of the game. Upon starting Camelot Unchained, you must create your hero and then release him into the world to search for adventure. ![]() ![]() There are three playable factions for the player to choose from – the Arthurians, the Vikings and the Irish tribe of Tuatha Dé Danann. Just like its archetype, the game focuses on Realm versus Realm battles (so–called global PvP). Some of the better-positioned upcoming games are Camelot Unchained and. The action takes place in a fantasy world, a mythical version of medieval Europe. BDO: Quest Tip Unchained Curiosity Nov 3 Posted by Riott If you are on your way. ![]() 5/2/2023 0 Comments Php imagemagick![]() ![]() You have to install a version of Imagick on your system that matches the PHP extension version.Īs others have instructed, download the latest PECL package for imagick for your PHP version. You can't used the latest Imagick (version 7 at the time of writing this) if you want to use the PHP extension, until the extension is upgraded. Luckily, all that is necessary is the latest PECL package and the corresponding version of Imagick for your system, which was the tricky part. At first I was copying DLLs all over the place like all of the instructions have you do. I am so cutting edge as to be using PHP 7.1 at the moment. This final example tiles text over the entire image which makes it far more difficult to remove.There are a lot of answers out there, as the landscape for this program and PHP have changed over time. To get around this foolish behavior, I’ve created my palettes with the same dimensions as the source image so no clipping takes place. This basically means that if I were to clip the edges then my watermark would lose its place at the bottom right and be re-positioned in the top-left corner. In the command-line version of the code, the outside edges of the transparent image are clipped before the watermark is overlayed, but there appears to be a bug that prevents the compositeImage() method from preserving the position defined by setGravity(). When I apply the mask by combining the images, any grey shades found in $mask as a result of anti-aliasing will be semi-transparent and result in smoother edges. The first image $watermark is grey-scale, and the second image $mask uses pure black for the parts I want to be transparent and white for the parts I want to keep. Several images are created in this example. $image->compositeImage($watermark, Imagick::COMPOSITE_DISSOLVE, 0, 0) $watermark->compositeImage($mask, Imagick::COMPOSITE_COPYOPACITY, 0, 0) $watermark->annotateImage($draw, 10, 12, 0, $text) Position text at the bottom right of the image $mask->newImage($width, $height, new ImagickPixel('black')) $watermark->newImage($width, $height, new ImagickPixel('gre圓0')) gravity center -draw "fill grey70 text 0,0 'Copyright'"Ĭonvert -size 300x50 xc:black -font Arial -pointsize 20 -gravity centerĬomposite -compose CopyOpacity mask.png fgnd.png stamp.pngĬomposite -gravity south -geometry +0+10 stamp.png image.png But while this works, the text stands out too drastically from the image and the effect should probably be more subtle.įor a smoother effect on the watermark text, you can make the text string transparent using a font mask.Ĭommand line example: convert -size 300x50 xc:gre圓0 -font Arial -pointsize 20 ![]() This example is pretty straight-forward and the code’s comments make it so you shouldn’t need much extra explanation. Draw text again slightly offset with a different color $draw->setGravity(Imagick::GRAVITY_SOUTHEAST) Position text at the bottom-right of the image ![]() The command line example is: convert image.png -font Arial -pointsize 20Īnd the PHP equivalent is: setFont('Arial') The easiest type of textual watermark to create is a string overlay on top of the image. ![]() ![]() ![]() Wonder Woman 1984 opens November 1st 2019. Perhaps Cassie Sandsmark aka Wonder Girl? Or am I just thinking like an idiot fanboy? I have a funny feeling about the casting of Wilde, in that she looks like someone who could be a fellow Amazon just like Gadot’s Diana. Rothwell is a producer and co-star on HBO’s Insecure, but she was really great as a scene-stealer in the teen comedy Love, Simon. Patel wrote, directed, and was featured in the hit documentary Meet the Patels, which is now being turned into a feature film. Wilde may be best known for the recent Endless Love remake that saw her co-star with Alex Pettyfer. Now the cast has grown bigger with three more additions.Īccording to Deadline, the film has added Gabriella Wilde, Natasha Rothwell, and Ravi Patel, although we have no idea who they’ll be playing. A botched store robbery places Wonder Woman in a global battle against a powerful and mysterious ancient force that puts her powers in jeopardy. We know Kristen Wiig will bear her claws as the Cheetah, while Pedro Pascal has an undisclosed role. Wonder Woman 1984 2020 Directed by Patty Jenkins Synopsis A new era of wonder begins. That said, I’m hugely impressed by the cast being assembled to join returning stars Gal Gadot and Chris Pine. She worked alongside Emerson, assisting Lord in running Black Gold Cooperative. They probably shouldn’t have shown anything. Gabriella Wilde Raquel was the secretary and later assistant of Max Lord. Filming started in June 2012 and it became released in October 2013.To be perfectly honest, I wasn’t impressed by the Wonder Woman 1984 footage screened at Comic-Con last week, but the produciton only just began and the effects were very early. Diana indulges in the modern amenities of the mid-1980s yet continues to mourn for her lost love, Steve Trevor (Chris Pine). The film became directed by Boys Don’t Cry director Kimberly Peirce and starred Chloë Grace Moretz and Julianne Moore. Decades after she defeated Ares amidst the First World War, Diana Prince (Gal Gadot) strives to lead an everyday existence as the Cold War sets the United States on edge. As well as Dark Horse, Gabriella became cast in the 2013 remake, Carrie, that same month (as Sue Snell). ![]() In May 2010, Gabriella appeared in an episode of the BBC television series Doctor Who as one of the eponymous vampires in “The Vampires of Venice”. ![]() In December 2009, Gabriella made her acting debut in the adventure comedy film St Trinian’s 2: The Legend of Fritton’s Gold. Wonder Woman 1984 vedrà il ritorno dello Steve Trevor di Chris Pine, immolatosi alla fine dell’originale Wonder Woman, di Robin Wright e Connie Nielsen di nuovo nei panni delle amazzoni Antiope e Hippolyta.Il cast è completato dalle new entry Natasha Rothwell, Ravi Patel e Gabriella Wilde. In addition, Gabriella studied fine art at the City and Guilds of London Art School but dropped out to pursue acting. Gabriella smuggled vodka into Heathfield, resulting in suspension and a transfer to St Swithun’s. The film was due to open in June this year but was delayed due to the Covid-19 pandemic. ![]() Later on, Gabriella attended Heathfield St Mary’s School, Ascot, and St Swithun’s School, Winchester, prior to leaving to pursue a course in art while continuing with her modelling career. Wonder Woman 1984 will be released in cinemas on October 2, 2020. She was educated at Windlesham House School. ![]() 5/2/2023 0 Comments Old norse translator![]() ![]() It explores (1) the regional and textual conditions for the survival of such loans and (2) their expansion into late medieval London English and into the emerging standard language. This paper focuses on Norse lexical loans that survived during and beyond the period of French rule and became part of this basic vocabulary. Most of the Norse legal and administrative terms attested in Old English were replaced by equivalents from the French superstrate soon after the Norman Conquest, whereas a remarkable number of more basic terms are known to have become part of the very basic vocabulary of modern Standard English. The material has a predominantly ecclesiastical and learned character, and yet it represents a mode of literacy quite distinct from the familiar contemporary manuscript culture The examples which now allow us to define this group are published here, most of them for the first time. The phase is represented particularly by a number of recently found inscriptions on pieces of lead sheet. ![]() The present paper identifies a ‘Late Anglo-Saxon’ phase, defined in terms of runographic practice and historical and archaeological context rather than linguistic criteria, although interestingly runic inscriptions of Latin text are prominent in this set. Pre-Old English and Early Old English phases that cover the fifth century AD to the ninth can be defined on linguistic grounds concurrently, quite distinctive forms and uses of text are associated with each of these phases. Three principal historical stages can now be identified. Few of these inscriptions can be disparaged as mere graffiti, and it is in fact clear that there is a significant patterning in the types of text written in runes in successive phases within the more than six centuries of the Anglo-Saxon Period. The corpus of runic inscriptions from Anglo-Saxon England is growing steadily, and the evidence of several recent finds sheds valuable new light on the range and role of literacy in this culture as well as on early forms of the Old English language and its dialects. Both words offer important evidence for biblical translation practices, and contribute to our knowledge about the Christianisation of Norse speaking peoples and Anglo-Norse language contact in Viking Age England. In the absence of clear-cut linguistic criteria for identifying loan translations between these two closely related languages, this paper draws on a range of literary evidence to argue for a strong likelihood of a relationship between the two compounds. ‘neck-book’) – that have traditionally been considered loan translations from Old English to Old Norse with little evidence other than their formation from cognate elements. Much of this material requires reassessment and this paper provides a case study of two parallel compound formations in both languages – OE bærsynnig /ON bersynðugr (‘one who is openly sinful publican’), and OE healsbōc /ON hálsbók (‘phylactery, amulet’, lit. from Old English to Old Norse, which have not attracted the same amount of attention in current scholarship. However, there are a significant number of words that have been considered borrowings in the “other” direction, i. A recent resurgence of interest in Old Norse linguistic borrowings in Old English has greatly expanded our knowledge of the contact situation between these two speech communities in the early medieval period and beyond. ![]() |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |